Want to know:
Quelle est la durée de gestation chez la vache ?
Get a detailed, AI-powered explanation for this question and thousands more on StudyFetch.
Get the Answer for FreeHow StudyFetch Helps You Master This Topic
AI-Powered Answers
Get instant, detailed explanations powered by AI that understands your course material.
Deep Understanding
Go beyond surface-level answers with step-by-step breakdowns and examples.
Personalized Learning
Spark.E adapts to your learning style and helps you connect ideas.
Practice & Test
Turn any question into flashcards, quizzes, and practice tests to solidify your knowledge.
Explore More Questions
- "life in austerity britain is consciously cruel"
- Soit la séquence suivante comprenant la fin d'un exon 1, un intron 1 et le début de l'exon 2 :AUGAUUACGG CUAGCUAGCG UGGGCUUACG AACCAGAUCGAUACGAUAUG AGAUAACGAG AUUCGAUACC AGAGAACAGA GAUAUa) Au niveau de quel nucléotide se situe le début de l'intron ?b) Au niveau de quel nucléotide se situe la fin de l'intron ?c) Quelle séquence sera éliminée lors de l'épissage ?
- Nvelle définition VDF : - atteinte liberté indiv - extinction droit propriété- non rattaché pv AA