Back to Questions
Want to know:
A client exhibits weakness, atrophy, and fasciculations of the right side of the tongue and lower face. The client also has right vocal-fold weakness and nasal regurgitation of fluid when swallowing. These problems are the result of a single tumor of the nervous system. The tumor is most likely located in which part of the nervous system?A, brain stemB. cerebellumC. left cerebral cortexD. right cerebral cortexE. lumbar spinal cord
Get a detailed, AI-powered explanation for this question and thousands more on StudyFetch.
Get the Answer for FreeHow StudyFetch Helps You Master This Topic
AI-Powered Answers
Get instant, detailed explanations powered by AI that understands your course material.
Deep Understanding
Go beyond surface-level answers with step-by-step breakdowns and examples.
Personalized Learning
Sparky adapts to your learning style and helps you connect ideas.
Practice & Test
Turn any question into flashcards, quizzes, and practice tests to solidify your knowledge.
Explore More Questions
- What were two outcomes of the Preston Brooks' 1856 attack on Charles Sumner? Select all that apply.-Both men were re-elected to their positions.-Brooks became a hero in the North.-Sumner died of his injuries.-Sumner became a martyr in the North.
- How many amino acids are encoded by the following mRNA?5′GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3′
- An Inuit group subsists by hunting seals, caribou, and birds, and by gathering local berries. Which of the following subsistence strategies is the group using?a.) food foraging b.) horticulture c.) agricultured.) pastoralism