Back to Questions
Want to know:
At each __________ , a four-nucleotide sequence is repeated many times in a row. The number of repeats varies widely within the human population. For example: AGATAGATAGATAGATAGAT
Get a detailed, AI-powered explanation for this question and thousands more on StudyFetch.
Get the Answer for FreeHow StudyFetch Helps You Master This Topic
AI-Powered Answers
Get instant, detailed explanations powered by AI that understands your course material.
Deep Understanding
Go beyond surface-level answers with step-by-step breakdowns and examples.
Personalized Learning
Spark.E adapts to your learning style and helps you connect ideas.
Practice & Test
Turn any question into flashcards, quizzes, and practice tests to solidify your knowledge.
Explore More Questions
- warfarin is used to suppress coagulation by acting as an antagonist of vitamin K and used short-term or long-term?
- Read the passage from Sugar Changed the World.In the 1100s, the richest Europeans slowly began to add more flavor to their food—because of a series of fairs and wars. A smart count in the Champagne region of France guaranteed the safety of any merchant coming to sell or trade at the markets in the lord's lands. Soon word spread, and the fairs flourished. Starting around 1150, the six Champagne fairs became the one place where Europeans could buy and sell products from the surrounding world—a first step in connecting them to the riches and tastes beyond. Fortress Europe was slowly opening up.What evidence from the passage best supports the inference that Europe was dangerous for merchants to travel to before the 1100s?
- Though a "record of their conversation reveals him to be quite rational, if rather long-winded, in his comments and analyses," Girija Mookerjee wrote that the meeting was "a disappointment for Subhas Bose. His aides at the Free India Center were curious to hear his opinion about __________, whom Bose dubbed as "baddha pagal" (raving mad in Bengali.)