Want to know:
Eli Whitney's invention of the cotton gin greatly increasesthe demand for slave labor.
Get a detailed, AI-powered explanation for this question and thousands more on StudyFetch.
Get the Answer for FreeHow StudyFetch Helps You Master This Topic
AI-Powered Answers
Get instant, detailed explanations powered by AI that understands your course material.
Deep Understanding
Go beyond surface-level answers with step-by-step breakdowns and examples.
Personalized Learning
Spark.E adapts to your learning style and helps you connect ideas.
Practice & Test
Turn any question into flashcards, quizzes, and practice tests to solidify your knowledge.
Explore More Questions
- Saturn's moons formed in the same way as the Galilean moons formed around Jupiter. True or false? How do you know?a. True. Saturn is very similar to Jupiter in terms of size, mass, composition, and distance to the Sun; hence, their moons formed in the same way.b. False. Saturn was not hot enough during its system's formation to cause the densities of its regular moons to follow the condensation sequence.c. False. All of Saturn's moons were captured from asteroids or Kuiper belts, while the Galilean moons formed together with Jupiter.d. True. All Saturn's regular moons formed together with the planet, have prograde motion and follow the condensation sequence.
- Secured system access requires individuals to identify themselves and for a system to verify that they are who they say they are. This verification process is called_________.
- Given the mRNA sequence below, what polypeptide sequence could be formed? (4 points)AUCUUUGUAUGGGUACACGUUAUUGGUUAUAGAUCCCAUCGG