Want to know:
Which of the following statements is false about sexual orientation?A) It falls along a continuum, with its end points being exclusive attraction to same sex or other sex.B) It encompasses three distinct categories: lesbian/gay, heterosexual and bi-sexual.C) A one-time encounter is not an indicator of sexuality.D) Gender identity and sexual orientation are one in the same concepts.
Get a detailed, AI-powered explanation for this question and thousands more on StudyFetch.
Get the Answer for FreeHow StudyFetch Helps You Master This Topic
AI-Powered Answers
Get instant, detailed explanations powered by AI that understands your course material.
Deep Understanding
Go beyond surface-level answers with step-by-step breakdowns and examples.
Personalized Learning
Sparky adapts to your learning style and helps you connect ideas.
Practice & Test
Turn any question into flashcards, quizzes, and practice tests to solidify your knowledge.
Explore More Questions
- Given the mRNA sequence below, what polypeptide sequence could be formed? (4 points)AUCUUUGUAUGGGUACACGUUAUUGGUUAUAGAUCCCAUCGG
- A ball is released from rest on a no-slip surface, as shown in the figure. After reaching its lowest point, the ball begins to rise again, this time on a frictionless surface as shown in the figure. When the ball reaches its maximum height on the frictionless surface, it is
- An unknown compound A has the molecular formula C12H16O. Compound A absorbs strongly in the IR at 1700 cm-1. The NMR spectral data for compound A are given below. What is the structure of compound A?A) IB) IIC) IIID) IV