Bioinformatics
Explore questions in the Bioinformatics category that you can ask Spark.E!
- What might happen if a secretory protein is activated prematurely?
- how much larger is the transcriptome than the genome?
- Can you translate mRNA into an amino acid sequence if given a translation table similar to the one included in your textbook?
- How does the process of alternative splicing impact our view that a single gene codes for a single kind of protein?
- If given a DNA sequence, can you transcribe a gene sequence into a mRNA sequence using Chargaff's rules?
- Which cellular components carry out RNA processing?
- Which enzyme is responsible for carrying out the processes of transcription?
- if you change a gene sequence, what do you expect to happen to its protein product?
- What must happen to mRNA after it is transcribed by eukaryotic cells?
- What is the overall flow of information during gene expression/protein synthesis? State the orientation of each sequence
- in animals, what type of sequence is commonly used to construct a phylogeny & determine ancestry?
- approximately what proportion of the presently described species of life on Earth are accounted for in the Taxonomy database?
- what two sequences can you search the databases of GenBank with?
- put the following steps of a sequencing experiment in order from start to finish :- run PCR so that there are many copies of the sequence of interest- analyze the sequence using tools like BLAST- extract DNA from the organism/cells- send samples for sequencing
- what are 3 values that show how closely matched your sequence is to potential matches from the database?
- *9.18 Comparative genomics offers insights into the relationship between homologous genes and the organization of genomes. When the genome of C. elegans was sequenced, it was striking that some types of sequences were distributed nonrandomly. Consider the data obtained for chromosome V and the X chromosome shownbelow. The following figure shows the distribution of genes, the distribution of inverted and tandem repeat sequences, and conserved genes (the location of transcribed sequences in C. elegans that are highly similar toyeast genes).a. How do the distributions of genes, inverted and tandemrepeat sequences, and conserved genes compare?b. Based on your analysis in (a), what might you hypothesizeabout the different rates of DNA evolution (change) on the arms and central regions of autosomesin C. elegans?c. Curiously, meiotic recombination (crossing-over, discussed in Chapter 12, p. 333) is higher on the arms of autosomes, with demarcations between regions of high and low crossing-over at the boundaries between conserved and nonconserved genes seen in the physical map. Does this information support your hypothesis in (b)?
- 9.12 Describe the steps you would take to obtain a null allele in your favorite yeast gene (YFG) using homologous recombination if you have available a yeast strain that is sensitive to the antibiotic kanamycin, pBluescript II plasmids (see Chapter 8, p. 176) with the DNA inserts diagrammed in Figure 9.B, and are able to transform yeast with a targeting vector, once you construct it. In Figure 9.B, EcoRI, HaeII, HindIII, and PstI are restriction enzymes (see Chapter 8, p. 174) that cleave these DNAs at the sites shown, and the distances between the sites aregiven in kb. As part of your answer, diagram the targeting vector you would construct and the structure of the chromosomal region once YFG is knocked out using this targeting vector. Also, describe how you would use PCR to confirm that you had obtained a null allele at the gene, and indicate on your diagrams the regions you would use for designing PCR primers. Remember that the absence of a PCR product does not provide strong evidence for a specific DNA arrangement, as a PCR could fail for any number of reasons.
- *9.11 If you assume that each step of the PCR process is100% efficient, how many copies of a template would beamplified after 30 cycles of a PCR reaction if the numberof starting template molecules werea. 10?b. 1,000?c. 10,000?
- 9.3 A dot plot provides a straightforward way to identifysimilar regions in pairs of sequences. In a dot plot, onesequence is written along the X-axis on a sheet of graph paper, and the second sequence is written along the Yaxis. A dot is placed in the plot whenever the nucleotidein a column on the X-axis matches the nucleotide in a row on the Y-axis.a. Construct a dot plot for each of the following pairs ofsequences, and then state where the plot reveals regionsof similarity between each pair of sequences.i. GCATTTAGAGCCCTAGTCGTGACAGATTCAGTTAGAGCCCTAGCTGATTGCii. AGCGATTGGTCCTGTACGAGCTAAGATGCACCTGTACGAGCCTTAb. Consider the results of your dot plots. What are someof the issues that the BLAST program, which performssequence similarity searches between a querysequence and sequences in a database, must address?
- 9.14 After the gene for an autosomal dominant humandisease was identified, sequence analysis of the mutant allele revealed it to be a missense mutation. Two alternate hypotheses are proposed for how the mutant allele could cause disease. In one hypothesis, the missense mutation alters a critical amino acid in the protein so that the protein is no longer able to function: heterozygotes with just one copy of the normal allele develop the disease because they have half of the normal dose of this protein's function. In the second hypothesis, the missense mutation alters the protein so that it interferes with a normal process: heterozygotes develop the disease because the mutant allele actively disrupts a required function. How could you gather evidence to support one of these alternate hypotheses using knockout mice?