Bioinformatics
Explore questions in the Bioinformatics category that you can ask Spark.E!
- 9.3 A dot plot provides a straightforward way to identifysimilar regions in pairs of sequences. In a dot plot, onesequence is written along the X-axis on a sheet of graph paper, and the second sequence is written along the Yaxis. A dot is placed in the plot whenever the nucleotidein a column on the X-axis matches the nucleotide in a row on the Y-axis.a. Construct a dot plot for each of the following pairs ofsequences, and then state where the plot reveals regionsof similarity between each pair of sequences.i. GCATTTAGAGCCCTAGTCGTGACAGATTCAGTTAGAGCCCTAGCTGATTGCii. AGCGATTGGTCCTGTACGAGCTAAGATGCACCTGTACGAGCCTTAb. Consider the results of your dot plots. What are someof the issues that the BLAST program, which performssequence similarity searches between a querysequence and sequences in a database, must address?
- 9.14 After the gene for an autosomal dominant humandisease was identified, sequence analysis of the mutant allele revealed it to be a missense mutation. Two alternate hypotheses are proposed for how the mutant allele could cause disease. In one hypothesis, the missense mutation alters a critical amino acid in the protein so that the protein is no longer able to function: heterozygotes with just one copy of the normal allele develop the disease because they have half of the normal dose of this protein's function. In the second hypothesis, the missense mutation alters the protein so that it interferes with a normal process: heterozygotes develop the disease because the mutant allele actively disrupts a required function. How could you gather evidence to support one of these alternate hypotheses using knockout mice?
- Is the path shown below relative or absolute? "/Users/montgomery/Documents"
- What is the most common high-throughput sequencing platform?
- Which of the following techniques is most likely to be used to sequence a genome today?
- What is the output of the following command line? "echo AGT | rev | tr ACGT TGCA"
- PCR is a common step when preparing DNA for high-throughput sequencing (i.e. during library preparation).
- The adapters added to next-gen sequencing libraries contain sequencing primer binding sites.
- When running trimmomatic on a paired-end dataset, how many output files are generated?
- Which of the following is an application involving De Bruijn graphs?
- How many bits are needed to represent the following set of character if 3 bytes are required: 010
- Illumina sequencing involves the incorporation of fluorescent nucleotides into DNA that distinguish A, C, T, and G.
- The adapters added to next-gen sequencing libraries can be used to distinguish different samples.
- Is the quality of the sequencing data being assessed below better towards the beginning or end of the reads?
- How much does it currently cost to sequence a human genome?
- What method was used to sequence the human genome?
- What file format is used to store information on where reads align within a genome?
- What year was the human genome published?
- You just sequenced a single genome sample using Illumina and you received two files with your data from the sequencing core. Was the sequencing mostly likely single-end or paired-end?
- What file format is used to store high-throughput sequencing data?